pET-3a-d

Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGlyCysEnd pET-3b ...GGTCGGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA ...GlyArgAspProAlaAlaAsnLysAlaArgLysGluAlaGluLeuAlaAlaAlaThrAlaGluGlnEnd ...TACCATGGCTAGC... pET-3c,d ...GGTCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAA MetAlaSer... ...GlyArgIleArgLeuLeuThrLysProGluArgLysLeuSerTrpLeuLeuProProLeuSerAsnAsnEnd CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG Nco I pET-3d Nde I T7•Tag T7 terminator BamH I Bpu1102 I T7 terminator primer #69337-3 pET-3a rbsBgl II Xba I T7 promoter primer #69348-3 T7 promoter The pET-3a-d vectors carry an N-terminal T7•Tag® sequence and BamH I cloning site. These vectors are the precursors to many pET family vectors; the pET-23a-d(+) series corresponds to pET-3a-d but incorporates several additional features. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. pET-3a sequence landmarks T7 promoter 615-631 T7 transcription start 614 T7•Tag coding sequence 519-551 T7 terminator 404-450 pBR322 origin 2814 bla coding sequence 3575-4432 The maps for pET-3b, pET-3c and pET-3d are the same as pET-3a (shown) with the following exceptions: pET-3b is a 4639bp plasmid; subtract 1bp from each site beyond BamH I at 510. pET-3c is a 4638bp plasmid; subtract 2bp from each site beyond BamH I at 510. pET-3d is a 4637bp plasmid; the BamH I site is in the same reading frame as in pET-3c. An Nco I site is substituted for the Nde I site with a net 1bp deletion at position 550 of pET-3c. As a result, Nco I cuts pET-3d at 546. For the rest of the sites, subtract 3bp from each site beyond position 551 in pET-3a. Nde I does not cut pET-3d. pET-3a-d cloning/expression region pET-3a-d Vectors TB026 12/98 pET-3a (4640bp) ori (2814) Ap (35 75 - 44 32) Cla I(24) Hind III(29) Bpu1102 I(458) BamH I(510) Nde I(550) Xba I(588) Bgl II(646) SgrA I(687) Sph I(843) EcoN I(903) Sal I(928) PshA I(993) Eag I(1216) Nru I(1251) ApaB I(1329) BspM I(1331) Bsm I(1636) Ava I(1702) Msc I(1723) Bpu10 I(1858) BscG I(1912) Pvu II(2343) BsmB I(2393) Tth111 I(2497) BsaA I(2504) Bst1107 I(2523) Sap I(2636) Afl III(2752) BspLU11 I(2752) AlwN I(3168) HgiE II(3338) Pst I(3890) Pvu I(4015) Sca I(4125) Ssp I(4449) Aat II(4567) EcoR I(4638) Apo I(4638) Eam1105 I(3645)– Cat. No. pET-3a DNA 69418-3 pET-3b DNA 69419-3 pET-3c DNA 69420-3 pET-3d DNA 69421-3 Enzyme # Sites Locations AatII 1 4567 AccI 2 929 2522 AceIII 5 974 2261 2402 2704 3944 AciI 86 AflIII 1 2752 AluI 18 AlwI 14 Alw21I 8 280 868 1455 1746 2570 3070 4231 4316 Alw44I 3 2566 3066 4312 AlwNI 1 3168 ApaBI 1 1329 ApoI 1 4638 AvaI 1 1702 AvaII 8 1076 1164 1413 1716 1758 2037 3783 4005 BamHI 1 510 BanI 9 76 119 690 711 825 1043 1482 1566 3593 BanII 2 752 766 BbsI 3 1007 1870 4623 BbvI 24 BccI 9 737 830 1267 1356 1663 1675 3682 3806 4093 Bce83I 7 399 962 1132 2843 3141 3382 4250 BcefI 3 887 1444 3254 BcgI 8 506 540 974 1008 2329 2363 4150 4184 BfaI 8 230 448 544 589 1766 3247 3500 3835 BglI 3 1212 1446 3765 BglII 1 646 BpmI 4 1109 1663 2279 3715 Bpu10I 1 1858 Bpu1102I 1 458 BsaI 2 613 3706 BsaAI 1 2504 BsaBI 3 645 651 1949 BsaHI 6 691 712 826 1483 4182 4564 BsaJI 9 115 129 435 805 811 1444 1646 1724 2912 BsaWI 6 380 970 1941 2958 3105 3936 BsbI 2 2468 4188 BscGI 1 1912 BsiI 3 2925 4309 4616 BsiEI 7 289 933 1219 2668 3092 4015 4164 BslI 21 BsmI 1 1636 BsmAI 4 613 2393 3706 4482 BsmBI 1 2393 BsmFI 4 829 1150 1375 2023 BsoFI 45 Bsp24I 10 513 545 658 690 3245 3277 3423 3455 4549 4581 Bsp1286I 10 280 752 766 868 1455 1746 2570 3070 4231 4316 BspEI 2 380 1941 BspGI 3 1336 1413 2278 BspLU11I 1 2752 BspMI 1 1331 BsrI 20 BsrBI 2 2685 4486 BsrDI 2 3706 3880 BsrFI 7 160 678 687 1046 1206 1560 3725 Bst1107I 1 2523 BstYI 9 510 646 1944 3393 3404 3490 3502 4270 4287 Enzyme # Sites Locations Cac8I 32 CjeI 18 CjePI 22 ClaI 1 24 CviJI 79 CviRI 21 DdeI 10 458 479 1858 2020 2560 3027 3436 3602 4142 4568 DpnI 25 DraI 2 2445 2860 DsaI 2 805 1724 EaeI 6 295 676 808 1216 1721 4033 EagI 1 1216 Eam1105I 1 3645 EarI 2 2636 4440 EciI 4 1672 2826 2972 3800 Eco47III 4 234 773 1054 2006 Eco57I 2 3300 4312 EcoNI 1 903 EcoO109I 5 431 801 1716 1758 4621 EcoRI 1 4638 EcoRII 6 129 1335 1718 2778 2899 2912 EcoRV 2 187 378 FauI 11 FokI 12 FspI 4 262 1635 1733 3867 GdiII 5 295 676 808 1216 4033 HaeI 7 1197 1269 1326 1723 2767 2778 3230 HaeII 11 HaeIII 23 HgaI 11 HgiEII 1 3338 HhaI 31 Hin4I 5 16 334 1418 3644 3718 HincII 2 930 4186 HindIII 1 29 HinfI 11 HphI 12 MaeII 10 1178 1234 1823 1847 2077 2503 3455 3871 4244 4564 MaeIII 17 MboII 11 MmeI 4 222 309 2967 3151 MnlI 30 MscI 1 1723 MseI 18 MslI 7 1308 1739 1934 2325 3897 4056 4415 MspI 28 MspA1I 7 462 1418 2343 2462 3094 3339 4280 MwoI 37 NarI 4 691 712 826 1483 NciI 10 171 812 1536 1762 2090 2396 2431 3132 3828 4179 NdeI 1 550 NgoAIV 4 678 1046 1206 1560 NheI 2 229 543 NlaIII 27 NlaIV 25 NruI 1 1251 NspI 4 843 2097 2389 2756 Pfl1108I 2 1035 3663 PflMI 2 1598 1647 PleI 5 629 917 2646 3131 3634 PshAI 1 993 Psp5II 2 1716 1758 Psp1406I 4 1178 2077 3871 4244 PstI 1 3890 Enzyme # Sites Locations PvuI 1 4015 PvuII 1 2343 RcaI 4 766 3472 4480 4585 RsaI 3 165 2558 4125 SalI 1 928 SapI 1 2636 Sau96I 16 Sau3AI 25 ScaI 1 4125 ScrFI 16 SfaNI 22 SfcI 5 138 614 3017 3208 3886 SgrAI 1 687 SphI 1 843 SspI 1 4449 StyI 2 435 1646 TaqI 9 24 339 643 651 929 1404 1545 2852 4296 TaqII 6 947 2654 3993 4178 4331 4348 TfiI 6 1129 1283 1581 1802 2306 2727 ThaI 25 TseI 24 Tsp45I 9 124 212 1157 1424 2191 2404 2499 3901 4112 Tsp509I 10 58 251 580 630 1596 1610 3512 3818 4073 4638 Tth111I 1 2497 Tth111II 5 2213 3342 3349 3381 4637 UbaJI 21 VspI 2 629 3817 XbaI 1 588 XmnI 2 2310 4244 Enzymes that do not cut pET-3a: AflII AgeI ApaI AscI AvrII BaeI BclI BmgI BsaXI BseRI BsrGI BssHII BstEII BstXI Bsu36I DraIII DrdII FseI HpaI KpnI MluI MunI NcoI NotI NsiI NspV PacI PmeI PmlI RleAI RsrII SacI SacII SexAI SfiI SgfI SmaI SnaBI SpeI SrfI Sse8387I StuI SunI SwaI XcmI XhoI pET-3a Restriction Sites TB026 12/98 Novagen • FAX 608-238-1388 • E-MAIL novatech@novagen.com